Dictionary,Defintion,Meaning,What is Coding strand,Coincidence,Co-dominance,Co-dominant allelles,Codon,Coefficient,Cohesive ends,Co-evolution

Scholarships Dictionary Visa Details Study Abroad Exam Results Online Test Jobs

	Home
Molecular Biology Dictionary Molecular Biology Dictionary Part 2 Part 3 Ab - Acrocentric Acropetal - Additive Gene Effects Adenilate Cyclase - Adrenal Medulla Hormone Adsorp - Alatoxin AFLP - Amplified Fragment Length Polymorphism - Albino Aldosterone - Alkaloid Alkylting Agents - Allopatric Speciation Allopolyploid - Amino Acid Aminoacyl Site A-site - Amplification Amplify - Animal Cell Immobilization Cloning - Anthesis Anthocyanin - Antigenic Determinant Antihaemophilic Globulin - AP-1 Site Apex - Artificial Inembryonation Artificial Insemination - Atatic Attatched Growth Reactor - Autologous Cells Autolysis - Auxillary Bud Proliferation BABS ( Biosynthetic Antibody Binding Sites) - Bacteriophage Bacteriophage Lambda - Bar Barr Body - Beta Lactamase Biennial - Bio Accumulation Bio Augmentaion - Biogenesis

Home >> Molecular Biology Dictionary >> Coding Strand, Coincidence

Your Ad Here	Coding strand The strand of duplex DNA which contains the same base sequence (after substituting U of T) found in the mRNA molecule resulting from transcription of that segment of DNA. a.k.a. sense strand. The mRNA molecule is transcribed from the other strand, known as the template or antisense strand. Coding strand 5' ATGAAAGCTTTAGTGGGCGCCCGTAT 3' Template strand 3' TACTTTCGAAATCACCCGCGGGCATA 5' mRNA 5' AUGAAAGCUUUAGUGGGCGCCCGUAU 3' An ambiguous term intended to refer to one specific strand in a double-stranded gene. See Sense strand
Co-dominance The situation in which both alleles in a heterozygous individual are expressed, so that the phenotype of heterozygotes incorporates the phenotypic effect of each allele. For example, roan coat colour in cattle results from a mixture of red hairs and white hairs, caused by heterozygosity for the red allele and the white allele. Also, protein polymorphisms and microsatellites show co-dominance: heterozygotes have two bands, whereas homozygotes have only one band
Co-dominant alleles Alleles that produce independent effects when in the heterozygous condition. Codon 1. A set of three nucleotides in mRNA, functioning as a unit of genetic coding by specifying a particular amino acid during the synthesis of polypeptides in a cell. A codon specifies a transfer RNA carrying a specific amino acid, which is incorporated into a polypeptide chain during protein synthesis. The specificity for translating genetic information from DNA into mRNA, then to protein, is provided by codon-anticodon pairing. See anticodon; initiation codon; termination codon. Codon optimization An experimental strategy in which codons within a cloned gene-ones not generally used by the host cell translation system-are changed by in vitro mutagenesis to the preferred codons, without changing the amino acids of the synthesized protein	Your Ad Here
2. In a mRNA, a codon is a sequence of three nucleotides which codes for the incorporation of a specific amino acid into the growing protein. The sequence of codons in the mRNA unambiguously defines the primary structure fo the final protein. Of course, the codons in the mRNA were also present in the genomic DNA, but the sequence may be interrupted by introns. Coefficient A number expressing the amount of some change or effect under certain conditions (e.g., the coefficient of inbreeding). co-enzyme An organic molecule of low molecular weight and usually non-protein, such as a vitamin, that binds to an enzyme and promotes its catalytic activity
Your Ad Here	Co-evolution The evolution of complementary adaptations in two species caused by the selection pressure that each exerts on the other. It is common in symbiotic association, in insect-pollinated plants, etc. Cohesive ends Double-stranded DNA molecules with single-stranded ends which are complementary to each other, enabling the different molecules to join each other. a.k.a. protruding ends; sticky ends; overhang. cf cos ends. See extension. Coincidence The ratio of the observed frequency of double crossings-over to the expected frequency, where the expected frequency is calculated by assuming that the two crossing-over events occur independently of each other

	Home
Molecular Biology Dictionary Part 4 Part 5 Part 6 Bioinformatics - Biosynthesis Biotic Factor - B Lymphocytes, B Cells Block Copolymer - Blunt End Blunt End Cut - Breeding Value Breed not at Risk - Burgers Vectors CAAT/CAT Box - Canine Canola - CAT Assay CAAT Box - cDNA Clone cDNA Cloning - Cell Fusion Cell Generation Time - Cell Wall Cementide - Chain Terminator Chemically Defined Medium - Chitin Chitinase - Chromosomal Aberration Chromosomal Integration Site - Chromosome Walking Cilium - Clone Clone Bank - Coding Sequence Coding Strand - Coincidence Co integrate Vector System - Comparative Gene Mapping

Language >> English | Français | Español | Deutsch | Italiano | Portugues | Japanese | Korean | Sim-Chinese