Coding strand
The strand of duplex DNA which contains the same base sequence (after substituting U of T) found in the mRNA molecule resulting from transcription of that segment of DNA.
a.k.a. sense strand. The mRNA molecule is transcribed from the other strand, known as the template or antisense strand. Coding strand 5' ATGAAAGCTTTAGTGGGCGCCCGTAT 3' Template strand 3' TACTTTCGAAATCACCCGCGGGCATA 5' mRNA 5' AUGAAAGCUUUAGUGGGCGCCCGUAU 3' An ambiguous term intended to refer to one specific strand in a double-stranded gene. See Sense strand


