Logo
 Home | Sitemap | Contact us | Search | Language
Left Right
Home >> Biotechnology Dictionary>> Chromosome mutation Coefficient

Chromosome mutation - a change in the gross structure of a chromosome, usually causing severely deleterious effects in the organism They are often due to an error in pairing during the crossing-over stage of meiosis The main types of chromosome mutation are translocation, duplication, deletion and inversion.

Chromosome theory of inheritance - the theory that chromosomes carry the genetic information and that their behaviour during meiosis provides the physical basis for segregation and independent assortment.

Cistron - a DNA sequence that codes for a specific polypeptide; a gene.

Claims - the section of a patent that states, in detail, the uses and possible applications of the invention described in the patent.

Chromosome walking - a technique that identifies overlapping cloned DNA fragments that form one continuous segment of a chromosome These fragments can be generated either by random shearing or by partial digestion with a four-base-pair cutter such as Sau3A A series of colony hybridisations is then carried out, starting with some cloned fragment which has already been identified and which is known to be in the region encompassed by the overlapping clones This identified fragment is used as a probe to pick out clones containing adjacent sequences These are then used as probes themselves to identify clones carrying sequences adjacent to them and so on At each round of hybridisation one 'walks' further along the chromosome from the initial fragment.

Class switching - the process during which a plasma cell stops producing antibodies of one class and begins producing antibodies of another class.

Chymosin - an enzyme that clots milk; it is used in the manufacture of cheese.

Circularisation - a DNA fragment generated by digestion with a single restriction endonuclease will have complementary 5' and 3' extensions (sticky ends) If these ends are annealed and ligated, the DNA fragment will have been converted to a covalently closed circle, or circularised.

Cis heterozygote - a heterozygote that contains two mutations arranged in a cis configuration (eg, a+ b+ / a b).

Cis acting sequence - a nucleotide sequence that only affects the expression of genes located on the same chromosome.

Cleave - to break phosphodiester bonds of doublestranded DNA, usually with a type II restriction endonuclease aka to cut or digest.

Clonal propagation - asexual propagation of many new plants (ramets) from an individual (ortet); all have the same genotype.

Clonal selection - the production of a population of plasma cells all producing the same antibody in response to the interaction between a B lymphocyte producing that specific antibody and the antigen bound by that antibody.

Clone - 1 a group of cells or organisms that are genetically identical as a result of asexual reproduction, breeding of completely inbred organisms, or forming genetically identical organisms by nuclear transplantation.
2 group of plants genetically identical in which all are derived from one selected individual by vegetative propagation, without the sexual process.
3 a population of cells that all carry a cloning vehicle with the same insert DNA molecule.
4 verb: To clone To insert a DNA segment into a vectoror host chromosome See cloning.

Cloned strain or line - a strain or line descended directly from a clone.

Cloning - 1 the mitotic division of a progenitor cell to give rise to a population of identical daughter cells or clones.
2 incorporation of a DNA molecule into a chromosomal site or a cloning vector.
3 animal cloning: the creation: of a whole animal by mitotic divisions from a single diploid somatic cell, typically by the process of nuclear transfer (qv) Cloning by nuclear transfer from undifferentiated embryonic cells has been possible for many years, but its widespread application has been hampered by inability to culture embryonic cells from animals other than mice In 1997, Ian Wilmut and colleagues from Edinburgh showed that it is possible to create a whole animal from a cell taken from differentiated adult tissue, thereby opening up the possibility of widespread animal cloning.

Cloning vector - a small, self replicating DNA molecule usually a plasmid or viral DNA chromosome into which foreign DNA is inserted in the process of cloning genes or other DNA sequences of interest It can carry inserted DNA and be perpetuated in a host cell Also called a cloning vehicle, vector, or vehicle.

Closed continuous culture - a continuous culture in which inflow of fresh medium is balanced by outflow of corresponding volumes of spent medium Cells are separated mechanically from outflowing medium and added back to the culture cf open continuous culture; batch culture; continuous culture.

Coccus - a spherical bacterium Cocci may occur singly, in pairs, in groups of four or more, and in cubical packets.

Coconut milk - liquid endosperm of the coconut, often used to supply organic nutrients to cultured cells and tissues See addendum; organic complex; undefined.

Cocoon - a protective coverage for eggs and/or larvae produced by many invertebrates, such as the silkworm moth.

Co culture - the join t culture of two or more types of cells, such as a plant cell and a micro organism, or two types of plant cells Used in various dual-culture systems or in nurse culture.

Coding - the specification of a peptide sequence, by the code contained in DNA molecules.

Coding sequence - that portion of a gene which directly specifies the amino acid sequence of its protein product Non-coding sequences of genes include control regions, such as promoters, operators and terminators, as well as the intron sequences of certain eukaryotic genes.

Coding strand - the strand of duplex DNA which contains the same base sequence (after substituting U for T) found in the mRNA molecule resulting from transcription of that segment of DNA aka sense strand The mRNA molecule is transcribed from the other strand, known as the template or antisense strand Coding strand 5' ATGAAAGCTTTAGTGGGCGCCCGTAT 3
template strand 3' TACTTTCGAAATCACCC GCGGGCATA 5' mRNA5' AUGAAAGCUU UAGUGGGCGCCCGUAU 3'.

Co dominance - the situation in which both alleles in a heterozygous individual are expressed, so that the phenotype of heterozygotes incorporates the phenotypic effect of each allele For example, roan coat colour in cattle results from a mixture of red hairs and white hairs, caused by heterozygosity for the red allele and the white allele Also, protein polymorphisms and microsatellites show co-dominance: heterozygotes have two bands, whereas homozygotes have only one band.

Co dominant alleles - alleles that produce independent effects when in the heterozygous condition.

Codon - a set of three nucleotides in mRNA, functioning as a unit of genetic coding by specifying a particular amino acid during the synthesis of polypeptides in a cell A codon specifies a transfer RNA carrying a specific amino acid, which is incorporated into a polypeptide chain during protein synthesis The specificity for translating genetic information from DNA into mRNA, then to protein, is provided by codon antic odon pairing.

Codon optimisation - an experimental strategy in which codons within a cloned gene ones not generally used by the host cell translation system a rechanged by in vitro mutagenesis to the preferred codons, without changing the amino acids of the synthesised protein.

Coefficient - a number expressing the amount of some change or effect under certain conditions (eg, the coefficient of inbreeding).

Left Right